YOUR PPE STORE



Universal Primers

#

Primer

Sequences (5' ~ 3')

Plasmid

Manufacturer

1

28 glll

GTATGGGATTTTGCTAAACAAC

Ph.D. glll

New England Biolabs

1a

-96 glll

CCCTCATAGTTAGCGTAACG

Ph.D. glll

New England Biolabs

2

Ac5 Forward

ACACAAAGCCGCTCCATCAG

pAc5.1/V5-His

Invitrogen

3

AD Reverse

AGATGGTGCACGATGCACAG

AD

 

4

a-Factor

TACTATTGCCAGCATTGCTGC

Pichia (pMET)

Invitrogen

5

AOX1 Forward

GACTGGTTCCAATTGACAAGC

Pichia

Invitrogen

6

AOX1 Reverse

GCAAATGGCATTCTGACATCC

Pichia

Invitrogen

7

AS HSV Tag Primer

ATCCTCGGGGTCTTCCG

pIEx

Novagen

8

AS SoTag 18mer Primer

GTCCATGTGCTGGCGTTC

pIEx

Novagen

9

AUG1 Forward

CAATTTACATCTTTATTTATTAACG

Pichia

Invitrogen

10

AUG1 Reverse

GAAGAGAAAAACATTAGTTGGC

Pichia

Invitrogen

11

Bac Forward

TTTTACTGTTTTCGTAACAGTTTT

pBlueBac4.5

Invitrogen

12

Bac Reverse

CGGATTTCCTTGAAGAGAGTA

pBlueBacHis2

Invitrogen

13

Baculovirus (+15)Reverse

ACTTCAAGGAGAATTTCC

pMelBac

Invitrogen

14

BGH Reverse

TAGAAGGCACAGTCGAGG

Universal

 

15

BK Reverse

ACAGGAAACAGCTATGACCTTG

BK virus

 

16

BKRSV

CGCCATTTGACCATTCA

pBK-rsv

 

17

Bluescript KS

TCGAGGTCGACGGTATC

pBluescript

Stratagene

18

Bluescript SK

CGCTCTAGAACTAGTGGATC

pBluescript

Stratagene

19

CBDcenA

TCAACGGCACCACCTGCA

 

Novagen

20

CBDcexLEAD

TAGGTGCAACTGTTGTTCTG

 

Novagen

21

CBDclos

CAACACCAGTTGTAAATCCA

 

Novagen

22

cI Forward

GGATAGCGGTCAGGTGTT

pHybcI/HK

Invitrogen

23

Cite primer

GGGGACGTGGTTTTCCTTTG

pCITE

Novagen

24

CMV Forward

CGCAAATGGGCGGTAGGCGTG

Universal

 

25

CYC1 Reverse

GCGTGAATGTAAGCGTGAC

Cyc1

Invitrogen

26

DsbA

CGAGTATGCTGATACAGTGA

DsRed

Clontech

27

DsbC

GAATTTCTCGACGAACACCA

DsRed

Clontech

28

DsRed1-C

AGCTGGACATCACCTCCCACAACG

DsRed

Clontech

29

DsRed1-N

GTACTGGAACTGGGGGGACAG

DsRed

Clontech

30

DsRed-C

AAGAAGCCTGTGCAGCTACCAGG

DsRed

Clontech

31

DsRed-N

CGCCTTCTATTTCAAACTCGTGCC

DsRed

Clontech

32

EBV Reverse

GTGGTTTGTCCAAACTCATC

EBV

Invitrogen

33

EF-1a Forward

TCAAGCCTCAGACAGTGGTTC

 

 

34

EGFP-C

CATGGTCCTGCTGGAGTTCGTG

EGFP

Clontech

35

EGFP-N

CGTCGCCGTCCAGCTCGACCAG

EGFP

Clontech

36

GAL1 Forward

AATATACCTCTATACTTTAACGTC

Gal1

Invitrogen

37

Glprimer 1

TGTATCTTATGGTACTGTAACTG

 

 

38

Glprimer 2

CTTTATGTTTTTGGCGTCTTCCA

 

 

39

gp64 promoter

CTACTAGTAAATCAGTCACACC

 

 

40

gp64 Signal primer

GCGCTATTGTTTTATATGTGC

 

 

41

IE1 promoter primer

TGGATATTGTTTCAGTTGCAAG

pIEx, pBIEx

Novagen

42

Lamdagt10For

CTTTTGAGCAAGTTCAGGCCTGGTTAAG

Lambda GT10

Promega

43

Lamdagt10Rev

GAGGTGGCTTATGAGTATTTCTTCCAGG

Lambda GT10

Promega

44

Lamdagt11For

GGTGGCGACGACTCCTGGAGCCCG

Lambda GT11

Promega

45

Lamdagt11Rev

TTGACACCAGACCAACTGGTAATG

Lambda GT11

Promega

46

M13 Forward (-20)

GTAAAACGACGGCCAG

Universal

 

47

M13 Forward (-40)

GTTTTCCCAGTCACGAC

Universal

 

47b

M13 Reverse

CAGGAAACAGCTATGAC

Universal

 

48

pUCR/M13 Forward

CCCAGTCACGACGTTGTAAAACG

pUC

PGEM-T
PGEM-

49

pUCR/M13 Reverse

AGCGGATAACAATTTCACACAGGAA

pUC

PGEM-T PGEM-

50

MT Forward

CATCTCAGTGCAACTAAA

pMT/V5-His

Invitrogen

51

myc-His Reverse

ATGACCGGTATGCATATTCAG

 

 

52

OpIE2 Forward

CGCAACGATCTGGTAAACAC

pMIB/V5-His

Invitrogen

53

OpIE2 Reverse

GACAATACAAACTAAGATTTAGTCAG

pMIB/V5-His

Invitrogen

54

p10 Forward

GTATATTAATTAAAATACTATACTG

pTriEx-2 Hygro

Novagen

55

pBAD Forward

ATGCCATAGCATTTTTATCC

E.coli araBAD

Invitrogen

56

pBAD Reverse

GATTTAATCTGTATCAGG

E.coli araBAD

Invitrogen

57

pCDM8 Reverse

TAAGGTTCCTTCACAAAG

pCDM8

Invitrogen

58

pCEP Forward

AGAGCTCGTTTAGTGAACCG

 

 

59

pCMV Forward

GATCCGGTACTAGAGGAACTGAAAAAC

 

 

60

pDAB Forward

ATGCCATAGCATTTTTATCC

 

Invitrogen

61

pET Upstream Primer

ATGCGTCCGGCGTAGA (16)

 

 

62

pETBlueDOWN Primer

GTTAAATTGCTAACGCAGTCA

 

 

63

pETBlueUP Primer

TCACGACGTTGTAAAACGAC

 

 

64

pFastBac Forward

GGATTATTCATACCGTCCCA

pFastBac

Invitrogen

65

pFastBac Reverse

CAAATGTGGTATGGCTGATT

pFastBac

Invitrogen

66

pGAP Forward

GTCCCTATTTCAATCAATTGAA

pGAPz

Invitrogen

67

pGENE Forward

CTGCTATTCTGCTCAACCT

 

 

68

pGEX 3'

GAGCTGCATGTGTCAGAGG

Universal

 

69

pGEX 5'

GGCAAGCCACGTTTGGTG

Universal

 

70

pHook Forward

ACGGTGCATTGGAACGGAC

pHook-2, -3

Invitrogen

71

pHook Reverse

GATTGCGTCGCATCGACCC

pHook-2, -3

Invitrogen

72

pHybLex/Zeo Forward

AGGGCTGGCGGTTGGGGTTATTCGC

pHybLex/Zeo

Invitrogen

73

pHybLex/Zeo Reverse

GAGTCACTTTAAAATTTGTATACAC

pHybLex/Zeo

Invitrogen

74

PinPoint Sequencing primer

CGTGACGCGGTGGAGGGCG

PinPoint Xa-1, -2, -3, PinPoint Xa-1 T-vector

Promega

75

pJET1.2 Forward

CGACTCACTATAGGGAGAGCGGC

 

 

76

pJET1.2 Reverse

AAGAACATCGATTTTCCATGGCAG

 

 

77

pJG4-5 Forward

GATGCCTCCTACCCTTATGATGTGCC

pJG4-5

 

78

pJG4-5 Reverse

GGAGACTTGACCAAACCTCTGGCG

pJG4-5

 

79

Polyhedrin Forward

AAATGATAACCATCTCGC

pVL1393

Invitrogen

80

Polyhedrin Reverse

GTCCAAGTTTCCCTG (15)

pVL1393

Invitrogen

81

pQE-TriSystem Forward

GTTATTGTGCTGTCTCATC

 

 

82

pQE-TriSystem Reverse

TCGATCTCAGTGGTATTTGTG

 

 

83

pREP Forward

GCTCGATACAATAAAGCCC

pREP4

Invitrogen

84

pRset

CTAGTTATTGCTCAGCGGTGG

pRset

Invitrogen

85

pRH Forward

CTGTCTCTATACTCCCCTATAG

pRH

Invitrogen

86

pRH Reverse

CAAAATTCAATAGTTACTATCGC

pRH

Invitrogen

87

pRSET Reverse

TAGTTATTGCTCAGCGGTGG

pRSET

Invitrogen

88

pTarget Sequencing Primer

TTACGCCAAGTTATTTAGGTGACA

pTarget

Promega

89

pTrcHis Forward

GAGGTATATATTAATGTATCG

pTrcHis

Invitrogen

90

pTrcHis Reverse

GATTTAATCTGTATCAGG

pTrcHis

Invitrogen

91

pTRE 3'

CCACACCTCCCCCTGAAC

pTRE

BD Biosciences

92

pTRE 5'

CGCCTGGAGACGCCATCC

pTRE

 

93

pTriplEx 3'

ACTCACTATAGGGCGAATTG

pTriplEx

Clontech

94

pTriplEx 5'

CTCGGGAAGCGCGCCATTGTGTTGGT

pTriplEx

Clontech

95

pUni Forward

CTATCAACAGGTTGAACTG

pUni

Invitrogen

96

pUni Reverse

CAGTCGAGGCTGATAGCGAGCT

pUni

Invitrogen

97

pYESTrp Forward

GATGTTAACGATACCAGCC

pYESTrp

Invitrogen

98

pYESTrp Reverse

GCGTGAATGTAAGCGTGAC

pYESTrp

Invitrogen

99

QE Promoter

CCGAAAAGTGCCACCTG

pQE

Qiagen

100

QE Reverse

GTTCTGAGGTCATTACTGG

pQE

Qiagen

101

R-20mer Primer

CAGCTATGACCATGATTACG

pSTBlue-1

Novagen

102

RsaA Reverse

GCCGCGCCAGCGACGCGGAGGG

pCX

Invitrogen

103

RVprimer3

CTAGCAAAATAGGCTGTCCC

pGL / pCAT3

Promega

104

Rvprimer4

GACGATAGTCATGCCCCGCG

pGL / pCAT3

Promega

105

SeqL-A (proximal to attL1)

TCGCGTTAACGCTAGCATGGATCTC

pDONR201/pDONR207

Invitrogen

106

SeqL-B (proximal to attL2)

GTAACATCAGAGATTTTGAGACAC

pDONR201/pDONR207

Invitrogen

107

STag 18mer Primer

GAACGCCAGCACATGGAC

pIEx-1

Novagen

108

STag Primer

CGAACGCCAGCACATGGACA

pIEx-1

Novagen

109

Sp6 Promoter

GATTTAGGTGACACTATAG

Universal

 

110

SV40-pArev

CCTCTACAAATGTGGTATGG

pRL-SV40

 

111

SV40-Promoter

GCCCCTAACTCCGCCCATCC

pRL-SV40

 

112

T3 Promoter

ATTAACCCTCACTAAAGGGA

Universal

 

113

T7 EEV

ATGTCGTAATAACCCCGCCCCG

pAlterMAX, pSI, pCI, pCI-Neo, pCMVTnT, pTnT, phMGFP Vector, HaloTag pHT2, psiCHECK-1, -2

Promega

114

T7 gene 10 Primer

TGAGGTTGTAGAAGTTCCG

 

 

115

T7 Promoter

TAATACGACTCACTATAGGG

Universal

 

116

T7 Reverse

TAGTTATTGCTCAGCGGTGG

Universal

 

117

T7 Terminator

GCTAGTTATTGCTCAGCGG

Universal

 

118

U6 Primer

GGGCAGGAAGAGGGCCTAT

 

 

119

U-19mer Primer

GTTTTCCCAGTCACGACGT

M13mp18, pCITE

Novagen

121

V5 Reverse Primer

ACCGAGGAGAGGGTTAGGGAT

V5 Epitope

Invitrogen

122

VP22 Forward

GGCCACGGCGACTCGA

 

 

123

Xpress Forward

TATGGCTAGCATGACTGGT

Xpress Epitope

Invitrogen

124

VLH

TTGTGTGGAATTGTGAGCGG

 

 

125

VF2

TGCCACCTGACGTCTAAGAA

 

 

126

VR

ATTACCGCCTTTGAGTGAGC

 

 

127

TKpA Rev

CTTCCGTGTTTCAGTTAGC

 

 

128

pQE60-FW

CCCGAAAAGTGCCACCTG

 

 

129

pQE60-Rv

GTTCTGAGGTCATTACTGG

 

 

130

SeqL-A (ATTL1)

GCGAGAGTAGGGAACTGC

pENTR

Invitrogen

131

SeqL-B (ATTL2)

AACATCAGAGATTTTGAGACAC

pENTR

Invitrogen

132

pmirGlo F (7205bp)

GAGGTGCCTAAAGGACTGAC

pmirGlo

promega